Genetics

Custom Search

Structure & Function of the Universal Genetic Code

          Genetics is a unit that is constantly changing with technological advances.  The main stay still lies with the universal genetic code, DNA.  The double helix, (or twisted ladder) structure was discovered by James Watson and Francis Crick in the 1950’s.  DNA stands for deoxyribonucleic acid.  The building block for DNA is the organic material nucleotides.  Here is a chromosome that is being unwound so you can see the double helix located in area A. 

 

Basic structure of nucleotides

This is a diagram of one nucleotide
  • Adenine (A)
  • Guanine (G)
  • Thymine (T)
  • Cytosine (C)

 -One sugar (deoxyribose)

– One phosphate group

 

 Basic structure of DNA

A strand of DNA is the combination of nucleotides joining and forming the double helix shape.  This can occur in two ways; 1.  “Sides of the ladder,” which is phosphate groups bonded to deoxyribose sugars. 2.  “Rungs of the ladder,” are the nitrogenous bases bonded together. 

 

When DNA replicates the strand has to untwist, becoming straight.  After it is untwisted, the DNA unzips opening the strand at the bonded nitrogenous bases. Then complementary base pairing occurs.  Complementary base pairing is when nucleotides pair with the opposite base.  For instance Adenine only bonds with Thymine and Cytosine will only bond with Guanine. 

 Gene chromosomes theory is that chromosomes are located in the nucleus of the cell and are made of tine units called genes.  Every gene controls specific traits of the organism. 

 

Alleles are different expressions (forms) of a particular gene.  Another word that can be used to describe them is traits.  Most genes have two possible alleles; one dominant and one recessive.  Homologous chromosomes have alleles for specific genes at the same location on each chromosome. 

 

Genotype is the genetic expression determined by the DNA sequence.  It consists of one allele from each chromosome in a homologous pair.  Resulting in a two letter code representing a specific trait.  For example; TT, Tt, or tt. 

 

The phenotype is the physical appearance of that trait or the observable trait.  They are determined by the genotype and follow the two letter code. 

 

There are 3 basic genotypes;

1. Homozygous dominant: genotype has 2 dominant alleles, where dominant phenotype is expressed (TT)

2. Homozygous recessive: genotype has 2 recessive alleles, where recessive phenotype is expressed (tt)

3. Heterozygous (dominant):  genotype has 1 dominant and 1 recessive allele, dominant phenotype is expressed.  (Tt)

 

Mendel’s Laws:

1. Law of Dominance– states when heterozygous organisms are crossed, all offspring will show the dominant trait.

2. Law of segregation – states that alleles of a gene occur in pairs and are separated from each other during meiosis and recombined during fertilization.

3. Law of independent assortment– states different traits are inherited independently of one another. 

 

  Punnett Squares are charts that show the possible gene combinations for offspring from 2 parents.
– Symbols represent alleles
– Uppercase letter= dominant allele
– Lowercase letter = recessive allele

 One of the parent’s genotype goes on top of the Punnett square with one allele per column. The other parent’s goes on the left side of the Punnett square with one allele per row.  The corresponding trait is carried down or across the Punnett Square.  The possible genotype outcomes are established for the offspring. 

 

 1. Mom & Dad are both homozygous dominant.
2. Mom & Dad are both homozygous recessive.
3. Mom & Dad are both heterozygous dominant.
4. Mom is homozygous dominant & dad is homozygous recessive. 


 Studying Human Heredity

Some problems scientists who study human genetics encounter are:
-Humans cannot be mated and breed offspring as animals can
-Humans produce very few offspring
-Humans reproduce generations slow
-Ethical and legal problems

  Therefore most information about human heredity comes from studies of family trees and/or pedigree charts.

 Pedigree chart – A Pedigree Chart is a chart which tells someone all of the known phenotypes for an organism and its ancestors.  It can be used to track genetics traits through various animals or plants.  In this example square represent males, and circles females.  The shaded boxes are individuals that are color blind.  It also shows the offspring produced each generation.  Bill and Bonnie had two daughters, Barbara and Mary, who married Tom and Frank respectively.  Both were color blind. 

 

   Comparing DNA and RNA

 All cell activities involve both nucleic acids:

DNA and RNA

 

RNA stands for ribonucleic acid.

 

Comparing DNA and RNA

 DNA

Sugar = deoxyribose
Bases = adenine, cytosine, guanine, and thymine
Double stranded
Only one kind

 RNA

Sugar = ribose
Bases = adenine, cytosine, guanine, and uracil
Single stranded
3 kinds = mRNA, tRNA, and rRNA

  

Structure and function of RNA

      RNA only has one strand, uses uracil instead of thymine and contains ribose.
      RNA molecules main job = protein synthesis

 Types of RNA

  1. messenger RNA – contain instructions for assembling amino acids into proteins.  Carry the “message” from DNA
  2. ribosomal RNA – molecules involved in the structure of ribosomes.  (remember proteins are assembled on ribosomes)
  3. transfer RNA – transfer amino acids to the ribosome, undergoes base pairing with mRNA

 2 steps in protein synthesis

1.  Transcription
The process where a molecule of RNA is made from DNA.
Transcribe means to write out or copy.

  2.  Translation
The process of decoding a molecule or RNA into a protein molecule.
Translate means to interpret or decode.

This diagram shows both transcription and translation.  Step 1 shows the nucleus where the double strand DNA writes (transcribes) a mRNA to make a specific amino acid.  It takes the message to the ribosome at location 4.  The tRNA finds the complementary base pairing with the mRNA and attached to it is the amino acid that corresponds.

Understanding Transcription

  1. Transcription = DNA (in the nucleus) is used to create mRNA (messenger RNA).
  2. mRNA holds the message of what protein the ribosome will make.
  3. mRNA travels from the nucleus to a ribosome. 

 

Practice transcription

àmRNA is made by complementary base pairing.

àexception:  NO “T” in RNA, “A” bonds to “U” (uracil)

 Translate a strand of mRNA from this strand of DNA:

C C A T T G A C C A T A A C G G C C T T T A C T
↓            ↓  ↓                  ↓ ↓    ↓  ↓  
G G U A A C UG G U A UU G C C G G A A A U G A

Understanding Translation

  1. mRNA enters the ribosome.
  2. Every 3 base sequence on mRNA = codon

(instructions for one specific amino acid).

3.  Each codon has a complementary tRNA molecule

(transfer the amino acid to the ribosome)

4. The sequence of tRNA = anticodon (opposite complementary 3 base sequence).

5.  mRNA runs through the ribosome as amino acids are bonded together by peptide bonds.

6.  Start codons start protein chain & stop codons stop the chain.

 

Practice Translation

è Decode each codon from our mRNA, using of the reference tables provided. 

 DNA

C C A T T G A C C A T A A C G G C C T T T A C T
↓            ↓ ↓                  ↓ ↓      ↓ ↓   
G
G U A A C UG G U A UU G C C G G A A A U G A
mRNA
gly     asn      trp    tyr    cys    arg     lys      stop

Amino acid sequence

 

 Heredity and the environment 

  1.  The environment can influence the genetic instruction in organisms.
  2.  One study that supports this theory was done on Himalayan rabbits.

 Himalayan rabbit study
 a.    The fur color of Himalayan rabbits is affected by temperature.
b.    The gene for black fur is active at low temperatures.

  1.     Scientists hypothesized if white fur on the rabbit’s back is removed and covered with cold temperature, and then the covered area will grow in black.
2.       Scientists performed this experiment by shaving the back of Himalayan rabbits, covering the shaved area with an ice pack, and allowed the hair to grow back.
3.       Scientists discovered their theory was correct; the rabbit’s hair did grow in black.
4.       This shows that the environment can change the expression of a gene. 

  

Genetic Engineering

 Technique #1 Selective Breeding

Selective breeding – method of improving a species by allowing only individual organisms with desired characteristic to produce the next generation.

 Way to manipulate biodiversity & variation within the species

 Can decreases biodiversity & variation within the species. 

  

3 types of selective breeding

1. Hybridization – breeding technique that involves dissimilar individuals to bring together the best traits of both organisms.

 Example:  Cross between one disease resistant plant and one plant the produces the greatest food capacity.

 Result: offspring plants that are disease resistant and produce the most amount of food. 

  

2.    Inbreeding– technique to continue breeding of individuals with similar characteristics. 

 Example:  All pure breed pets are a result of breeding.

 Results:  inbreeds have a high risk of genetic defects. 

 

 

3.  Increasing variations– breeding technique that increases the genetic variation in a population by inducing mutations within the organism. 

 Process involves: exposing the organism to radiation & chemicals, hoping to produce beneficial mutations. 

Example:  producing new kinds of bacteria & plants

 New Bacteria: Scientists have produced oil-eating bacteria, useful in cleaning up oil spills by this method. 

 New Plants: Scientists have produced polyploidy plants (plant has an extra set of a chromosome).  This plant is larger and stronger than non-polyploids.  

 

 Technique #2 DNA Profiling

DNA profiling (DNA fingerprinting) – technique to analyze sections of DNA that vary from one individual to another, in order to identify an individual.

 – when the process is done correctly (no tampering), DNA profiling is 99.9% accurate evidence. 

  Steps to creating a DNA profile

  1. Obtain cells from desired individual (blood, urine, salvia, hair)
  2. Extract DNA from the cell using a centrifuge.

 PCR (polymerase chain reaction) occurs.  More DNA is created to make more accurate results. 

  1. Restriction enzymes are used to cut DNA strands into smaller fragments.

–    estriction enzymes specify on a sequence of bases. 

 Example: one restriction enzyme will cut in the middle of AATT every time AATT is present. 

 CCGAATTATCCGTTCCAATTGGATGCAATTCTT

 DNA fragments would be:

CCGAA, TTATCCGTTCCAA, TTGGATGCAA, and TTCTT

  1. Fluorescent dye is added to the DNA fragment mixture.  The mixture is added to the gel and is separated by electrophoresis. 
  2. Electric voltage is used to move the fragments towards the positive end.  The smaller fragments will move further. 
  3. Gel is exposed to see the bands of DNA. 
  4. DNA profile can be used for analysis. 

 

 Technique #3 Recombinant DNA

Cell Transformation (Recombinant DNA) – a cell takes in DNA from outside the cell

the external DNA becomes a part of the cell’s DNA

 

Example of Recombinant DNA

Scientists have transformed bacteria to produce human medications (insulin). 

  1. Extract human gene for producing insulin.
  2. Extract plasmid (bacteria DNA, circular shape)
  3. Cut plasmid
  4. Combine human gene and cut plasmid with enzymes.
  5. Insert transformed DNA into bacteria cell.  The transformed DNA is called Recombinant DNA. 
  6. Bacteria can now produce human insulin. 

 In this image, you can see the DNA fragment from the human cell is placed in the genetic material (plasmid) of the bacteria cell.  The bacteria will now incorporate the information into its DNA and produce the chemical the human DNA was providing. 

 

 

  Vocabulary with Recombinant DNA

 Transgenic – an organism that contain genes from another organism.
Transgenic microorganisms – bacteria are used to produce medications.
Transgenic animals– livestock have been created to produce leaner meat.
Transgenic plants – used to produce natural insecticides, resistance to weed-killing chemicals. 

 Cloning

Clone- member of a population of genetically identical organisms produced from a single cell.  The clone’s DNA will be identical to the parent DNA.

In this diagram a body cell was taken from Sheep A and the nucleus was extracted from it.  (That DNA will be the DNA of the clone later on.)  An egg cell was taken from the ovary of Sheep B, and the nucleus was extracted out and the nucleus from Sheep A was placed inside it.

The now fertilized egg will be placed into the uterus of Sheep C to act as a surrogate for development.  And after the development is complete the the lamb that is born will have the same DNA as Sheep A.